|
RNAlib-2.4.18
|
|
Abstract Shapes, introduced by Giegerich et al. in (2004) [10], collapse the secondary structure while retaining the nestedness of helices and hairpin loops. More...
Abstract Shapes, introduced by Giegerich et al. in (2004) [10], collapse the secondary structure while retaining the nestedness of helices and hairpin loops.
The abstract shapes representation abstracts the structure from individual base pairs and their corresponding location in the sequence, while retaining the inherent nestedness of helices and hairpin loops.
Below is a description of what is included in the abstract shapes abstraction for each respective level together with an example structure:
CGUCUUAAACUCAUCACCGUGUGGAGCUGCGACCCUUCCCUAGAUUCGAAGACGAG ((((((...(((..(((...))))))...(((..((.....))..)))))))))..
| Shape Level | Description | Result |
|---|---|---|
| 1 | Most accurate - all loops and all unpaired | [_[_[]]_[_[]_]]_ |
| 2 | Nesting pattern for all loop types and unpaired regions in external loop and multiloop | [[_[]][_[]_]] |
| 3 | Nesting pattern for all loop types but no unpaired regions | [[[]][[]]] |
| 4 | Helix nesting pattern in external loop and multiloop | [[][[]]] |
| 5 | Most abstract - helix nesting pattern and no unpaired regions | [[][]] |
Collaboration diagram for Abstract Shapes Representation of Secondary Structures:Functions | |
| char * | vrna_abstract_shapes (const char *structure, unsigned int level) |
| Convert a secondary structure in dot-bracket notation to its abstract shapes representation. More... | |
| char * | vrna_abstract_shapes_pt (const short *pt, unsigned int level) |
| Convert a secondary structure to its abstract shapes representation. More... | |
| char * vrna_abstract_shapes | ( | const char * | structure, |
| unsigned int | level | ||
| ) |
#include <ViennaRNA/utils/structures.h>
Convert a secondary structure in dot-bracket notation to its abstract shapes representation.
This function converts a secondary structure into its abstract shapes representation as presented by Giegerich et al. 2004 [10].
| structure | A secondary structure in dot-bracket notation |
| level | The abstraction level (integer in the range of 0 to 5) |
abstract_shapes() where the optional second parameter level defaults to 5. | char * vrna_abstract_shapes_pt | ( | const short * | pt, |
| unsigned int | level | ||
| ) |
#include <ViennaRNA/utils/structures.h>
Convert a secondary structure to its abstract shapes representation.
This function converts a secondary structure into its abstract shapes representation as presented by Giegerich et al. 2004 [10]. This function is equivalent to vrna_db_to_shapes(), but requires a pair table input instead of a dot-bracket structure.
pt[0]!| pt | A secondary structure in pair table format |
| level | The abstraction level (integer in the range of 0 to 5) |
abstract_shapes() where the optional second parameter level defaults to 5.